Products / Genes / Microbiology / Pathogenic microorganism

Human ICAM-3 / CD50 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

Summary
Catalog No:HG10333-ACG
NCBI RefSeq:1644 bp
Type:Expression-Ready ORF Clones
Gene ID:
Images(2)

Cynomolgus CD19/B4/CVID3 Gene Plasmid Map

CD50 Gene Expression validated Image

To buy,select size,quantity

Background

The protein ICAM-3, also known as CD50, is a member of the intercellular adhesion molecule (ICAM) family consisting three members. It is a DC-SIGN ligand that is constitutively expressed on resting leukocytes, and is thus an important molecule for the first immune response. ICAM-3 comprises of five immunoglobulin-like domains, and binds LFA-1 throµgh its two N-terminal domains. It functions not only as an adhesion molecule, but also as a potent signalling molecule. ICAM-3 binds to LFA-1 on antigen-presenting cells (APC) stabilizing the T cell-APC interaction, facilitating signaling throµgh the CD3/TCR complex. However, recent evidence using cultured and transformed T cells sµggests ICAM-3 may also function in signaling. It has been reported that CD50 molecule can play a role in developing functionally mature T lymphocytes and its expression increases during the maturation process of T lymphocytes. In addition, the interactions of ICAM-3 and LFA-1 facilitate HIV-1- induced virological synapse formation between T cells. ICAM-3 is associated with an increase of cellular radio-resistance and cancer cell proliferation. It could be considered as a candidate for anti-cancer drµg development and as a cancer diagnostic marker.

Human ICAM-3 / CD50 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag Product information

Molecule NameICAM3
RefSeq ORF Size1644 bp
cDNA DescriptionHuman ICAM-3 / CD50 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (HG10333-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
SynonymCD50, CDW50, ICAM-R
VectorpCMV3-C-GFPSpark
PlasimidpCMV3-ICAM3-GFPSpark
Restriction siteHindIII + XbaI (6kb + 2.37kb)
Tag SequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence DescriptionIdentical with the Gene Bank Ref. ID sequence.
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Human ICAM-3 / CD50 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag images

Cynomolgus CD19/B4/CVID3 Gene Plasmid Map

CD50 Gene Expression validated Image

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

Neucleotide sequence and amino acid sequence

Yellow:linker
Green:GFP tag
 
ATGGCCACCATGGTACCATCCGTGTTGTGGCCCAGGGCCTGCTGGACTCTGCTGGTCTGCTGTCTGCTGACCCCAGGTGTCCAGGGGCAGGAGTTCCTTTTGCGGGTGGAGCCCCAGAACCCTGTGCTCTCTGCTGGAGGGTCCCTGTTTGTGAACTGCAGTACTGATTGTCCCAGCTCTGAGAAAATCGCCTTGGAGACGTCCCTATCAAAGGAGCTGGTGGCCAGTGGCATGGGCTGGGCAGCCTTCAATCTCAGCAACGTGACTGGCAACAGTCGGATCCTCTGCTCAGTGTACTGCAATGGCTCCCAGATAACAGGCTCCTCTAACATCACCGTGTACGGGCTCCCGGAGCGTGTGGAGCTGGCACCCCTGCCTCCTTGGCAGCCGGTGGGCCAGAACTTCACCCTGCGCTGCCAAGTGGAGGGTGGGTCGCCCCGGACCAGCCTCACGGTGGTGCTGCTTCGCTGGGAGGAGGAGCTGAGCCGGCAGCCCGCAGTGGAGGAGCCAGCGGAGGTCACTGCCACTGTGCTGGCCAGCAGAGACGACCACGGAGCCCCTTTCTCATGCCGCACAGAACTGGACATGCAGCCCCAGGGGCTGGGACTGTTCGTGAACACCTCAGCCCCCCGCCAGCTCCGAACCTTTGTCCTGCCCGTGACCCCCCCGCGCCTCGTGGCCCCCCGGTTCTTGGAGGTGGAAACGTCGTGGCCGGTGGACTGCACCCTAGACGGGCTTTTTCCAGCCTCAGAGGCCCAGGTCTACCTGGCGCTGGGGGACCAGATGCTGAATGCGACAGTCATGAACCACGGGGACACGCTAACGGCCACAGCCACAGCCACGGCGCGCGCGGATCAGGAGGGTGCCCGGGAGATCGTCTGCAACGTGACCCTAGGGGGCGAGAGACGGGAGGCCCGGGAGAACTTGACGGTCTTTAGCTTCCTAGGACCCATTGTGAACCTCAGCGAGCCCACCGCCCATGAGGGGTCCACAGTGACCGTGAGTTGCATGGCTGGGGCTCGAGTCCAGGTCACGCTGGACGGAGTTCCGGCCGCGGCCCCGGGGCAGCCAGCTCAACTTCAGCTAAATGCTACCGAGAGTGACGACGGACGCAGCTTCTTCTGCAGTGCCACTCTCGAGGTGGACGGCGAGTTCTTGCACAGGAACAGTAGCGTCCAGCTGCGAGTCCTGTATGGTCCCAAAATTGACCGAGCCACATGCCCCCAGCACTTGAAATGGAAAGATAAAACGAGACACGTCCTGCAGTGCCAAGCCAGGGGCAACCCGTACCCCGAGCTGCGGTGTTTGAAGGAAGGCTCCAGCCGGGAGGTGCCGGTGGGGATCCCGTTCTTCGTCAACGTAACACATAATGGTACTTATCAGTGCCAAGCGTCCAGCTCACGAGGCAAATACACCCTGGTCGTGGTGATGGACATTGAGGCTGGGAGCTCCCACTTTGTCCCCGTCTTCGTGGCGGTGTTACTGACCCTGGGCGTGGTGACTATCGTACTGGCCTTAATGTACGTCTTCAGGGAGCACCAACGGAGCGGCAGTTACCATGTTAGGGAGGAGAGCACCTATCTGCCCCTCACGTCTATGCAGCCGACAGAAGCAATGGGGGAAGAACCGTCCAGAGCTGAGGGGGGTGGAGGCTCTGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGAAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGCTAACTTCAAGGTTCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA
 
MATMVPSVLWPRACWTLLVCCLLTPGVQGQEFLLRVEPQNPVLSAGGSLFVNCSTDCPSSEKIALETSLSKELVASGMGWAAFNLSNVTGNSRILCSVYCNGSQITGSSNITVYGLPERVELAPLPPWQPVGQNFTLRCQVEGGSPRTSLTVVLLRWEEELSRQPAVEEPAEVTATVLASRDDHGAPFSCRTELDMQPQGLGLFVNTSAPRQLRTFVLPVTPPRLVAPRFLEVETSWPVDCTLDGLFPASEAQVYLALGDQMLNATVMNHGDTLTATATATARADQEGAREIVCNVTLGGERREARENLTVFSFLGPIVNLSEPTAHEGSTVTVSCMAGARVQVTLDGVPAAAPGQPAQLQLNATESDDGRSFFCSATLEVDGEFLHRNSSVQLRVLYGPKIDRATCPQHLKWKDKTRHVLQCQARGNPYPELRCLKEGSSREVPVGIPFFVNVTHNGTYQCQASSSRGKYTLVVVMDIEAGSSHFVPVFVAVLLTLGVVTIVLALMYVFREHQRSGSYHVREESTYLPLTSMQPTEAMGEEPSRAEGGGGSVSKGEELFTGVVPILVELDGDVNGHKFSVSGEGEGDATYGKLTLKFICTTGKLPVPWPTLVTTLTYGVQCFSRYPDHMKKHDFFKSAMPEGYVQERTIFFKDDGNYKTRAEVKFEGDTLVNRIELKGIDFKEDGNILGHKLEYNYNSHNVYIMADKQKNGIKANFKVRHNIEDGSVQLADHYQQNTPIGDGPVLLPDNHYLSTQSALSKDPNEKRDHMVLLEFVTAAGITLGMDELYK-

Ask Us About This Product

submit your question on HG10333-ACG below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed