Products / Genes / Cell Biology / Apoptosis(C)

Human DcR3/TNFRSF6B transcript variant M68E Gene ORF cDNA clone expression plasmid, C-His tag

Summary
Catalog No:HG10224-CH
NCBI RefSeq:903 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

Tumor necrosis factor receptor superfamily member 6B (TNFRSF6B) also known as DcR3(Decoy Receptor 3) and M68 is the tumor necrosis factor receptor superfamily. DcR3/TNFRSF6B belongs to the tumor necrosis factor receptor superfamily. The encoded protein is postulated to play a regulatory role in suppressing FasL- and LIGHT-mediated cell death. It acts as a decoy receptor that competes with death receptors for ligand binding. Over-expression of this gene has been noted in gastrointestinal tract tumors. Read-throµgh transcription into this gene from the neighboring upstream gene, which encodes regulator of telomere elongation helicase 1 (RTEL1), generates a non-coding transcript. DcR3/TNFRSF6B is detected in fetal lung, brain and liver. DcR3/TNFRSF6B is also detected in adult stomach, spinal cord, lymph node, trachea, spleen, colon and lung. This protein is highly expressed in several primary tumors from colon, stomach, rectum, esophagus and in SW480 colon carcinoma cells.

Human DcR3/TNFRSF6B transcript variant M68E Gene ORF cDNA clone expression plasmid, C-His tag Product information

Molecule NameTNFRSF6B
RefSeq ORF Size903 bp
cDNA DescriptionHuman DcR3/TNFRSF6B transcript variant M68E Gene ORF cDNA clone expression plasmid, C-His tag (HG10224-CH) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-His Vector) to other plasmid vectors.
SynonymDCR3, DJ583P15.1.1, M68, M68E, TNFRSF6B, TR6
VectorpCMV3-C-His
Plasimid
Restriction site
Tag SequenceHis Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on HG10224-CH below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed