Products / Genes / Microbiology / Pathogenic microorganism

Human Cyclophilin A Gene ORF cDNA clone expression plasmid, C-Myc tag

Summary
Catalog No:HG10436-CM
NCBI RefSeq:498 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

Mouse peptidyl-prolyl cis-trans isomerase A, also known as PPIase A, Rotamase A, Cyclophilin A, Cyclosporin A-binding protein, PPIA and CYPA, is a cytoplasm protein which belongs to the cyclophilin-type PPIase family and PPIase A subfamily. Cyclophilins (CyPs) are a family of proteins found in organisms ranging from prokaryotes to humans. These molecules exhibit peptidyl-prolyl isomerase activity, sµggesting that they influence the conformation of proteins in cells. PPIA / Cyclophilin A accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. PPIA / Cyclophilin A is secreted by vascular smooth muscle cells in response to inflammatory stimuli, and could thus contribute to atherosclerosis. It is not essential for mammalian cell viability. PPIA / Cyclophilin A can interact with several HIV proteins, including p55 gag, Vpr, and capsid protein, and has been shown to be necessary for the formation of infectious HIV virions.

Human Cyclophilin A Gene ORF cDNA clone expression plasmid, C-Myc tag Product information

Molecule NamePPIA
RefSeq ORF Size498 bp
cDNA DescriptionHuman Cyclophilin A Gene ORF cDNA clone expression plasmid, C-Myc tag (HG10436-CM) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-Myc Vector) to other plasmid vectors.
SynonymCYPA, CYPH, HEL-S-69p
VectorpCMV3-C-Myc
Plasimid
Restriction site
Tag SequenceMyc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on HG10436-CM below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed