Products / Genes / Developmental Biology / Embryogenesis

Human CD112/Nectin-2/PVRL2 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

Summary
Catalog No:HG10005-ACG
NCBI RefSeq:1617 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

Cluster of Differentiation 112 (CD112), also known as poliovirus receptor related protein 2 (PVRL2 or PRR2), is a single-pass type I transmembrane glycoprotein belonging to the Immunoglobulin superfamily. CD112 protein also serves as an entry for certain mutant strains of herpes simplex virus and pseudorabies virus, and thus is involved in cell to cell spreading of these viruses. CD112 protein has been identified as the ligand for DNAM-1 (CD226), and the interaction of CD226/CD112 protein can induce NK cell- and CD8+ T cell-mediated cytotoxicity and cytokine secretion. CD112 has been regarded as a critical component in allergic reactions, and accordingly may function as a novel target for anti-allergic therapy.

Human CD112/Nectin-2/PVRL2 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-GFPSpark tag Product information

Molecule NamePVRL2
RefSeq ORF Size1617 bp
cDNA DescriptionHuman CD112/Nectin-2/PVRL2 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (HG10005-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
SynonymCD112, HVEB, Nectin-2, PRR2, PVRR2
VectorpCMV3-C-GFPSpark
Plasimid
Restriction site
Tag SequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on HG10005-ACG below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed