Products / Genes / Neuroscience / Cell Adhesion Proteins

Cynomolgus Profilin 2 / PFN2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

Summary
Catalog No:CG90562-ACG
NCBI RefSeq:423 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

Profilin 2, also known as PFN2,  is a ubiquitous actin monomer-binding protein belonging to the profilin family. It is highly expressed in brain, skeletal muscle and kidney and less strongly in heart, placenta, lung and liver. Profilin 2 binds to actin and affects the structure of the cytoskeleton. At high concentrations, profilin prevents the polymerization of actin, whereas it enhances it at low concentrations. Profilin 2 is thoµght to regulate actin polymerization in response to extracellular signals. It inhibits the formation of IP3 and DG by binding to PIP2.

Cynomolgus Profilin 2 / PFN2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag Product information

Molecule NamePFN2
RefSeq ORF Size423 bp
cDNA DescriptionCynomolgus Profilin 2 / PFN2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (CG90562-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
Synonym
VectorpCMV3-C-GFPSpark
Plasimid
Restriction site
Tag SequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on CG90562-ACG below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed