Products / Genes / Cancer / Cancer immunology

Cynomolgus IGSF8 Gene ORF cDNA clone expression plasmid, C-Flag tag

Summary
Catalog No:CG90732-CF
NCBI RefSeq:1845 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

Cynomolgus IGSF8 Gene ORF cDNA clone expression plasmid, C-Flag tag Product information

Molecule NameIGSF8
RefSeq ORF Size1845 bp
cDNA DescriptionCynomolgus IGSF8 Gene ORF cDNA clone expression plasmid, C-Flag tag (CG90732-CF) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-FLAG Vector) to other plasmid vectors.
Synonym
VectorpCMV3-C-FLAG
Plasimid
Restriction site
Tag SequenceFLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on CG90732-CF below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed