Products / Genes / Neuroscience / Cell Adhesion Proteins

Canine RhoA Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

Summary
Catalog No:DG70174-ACG
NCBI RefSeq:582 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

Transforming protein RhoA, also known as Rho cDNA clone 12, Ras homolog gene family member A, RHOA and ARH12, is a cell membrane and cytoplasm protein which belongs to the small GTPase superfamily and Rho family. The Rho family of small GTPases plays a key role in the dynamic regulation of the actin cytoskeleton that underlies various important cellular functions such as shape changes, migration, and polarity. RHOA / ARH12 is part of a larger family of related proteins known as the Ras superfamily; proteins involved in the regulation and timing of cell division. RHOA / ARH12 is a small GTPase protein known to regulate the actin cytoskeleton in the formation of stress fibers. It acts upon two known effector proteins: ROCK1 (Rho-associated, coiled-coil containing protein kinase 1) and DIAPH1 ( diaphanous homolog 1 (Drosophila) ). RHOA / ARH12 regulates a signal transduction pathway linking plasma membrane receptors to the assembly of focal adhesions and actin stress fibers. RHOA / ARH12 serves as a target for the yopT cysteine peptidase from Yersinia pestis, vector of the plague, and Yersinia pseudotuberculosis, which causes gastrointestinal disorders. RHOA / ARH12 may be an activator of PLCE1. It is activated by ARHGEF2, which promotes the exchange of GDP for GTP.

Canine RhoA Gene ORF cDNA clone expression plasmid, C-GFPSpark tag Product information

Molecule NameRHOA
RefSeq ORF Size582 bp
cDNA DescriptionCanine RhoA Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (DG70174-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
Synonym
VectorpCMV3-C-GFPSpark
Plasimid
Restriction site
Tag SequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on DG70174-ACG below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed