Products / Genes / Neuroscience / Cell Adhesion Proteins

Canine PAIP2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

Summary
Catalog No:DG70224-ACG
NCBI RefSeq:384 bp
Type:Expression-Ready ORF Clones
Gene ID:

To buy,select size,quantity

Background

Canine PAIP2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag Product information

Molecule NamePAIP2
RefSeq ORF Size384 bp
cDNA DescriptionCanine PAIP2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag (DG70224-ACG) - available for purchase from ABclonal - allows for easy subcloning of the ORF (pCMV3-C-GFPSpark Vector) to other plasmid vectors.
Synonym
VectorpCMV3-C-GFPSpark
Plasimid
Restriction site
Tag SequenceGFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence Description
Sequencing primersT7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
PromoterEnhanced CMV mammalian cell promoter
Application
Antibiotic in E.coliKanamycin
Antibiotic in mammalian cellHygromycin
Shipping carrierEach tube contains lyophilized plasmid.
StorageThe lyophilized plasmid can be stored at ambient temperature for three months.

Neucleotide sequence and amino acid sequence

Ask Us About This Product

submit your question on DG70224-ACG below

During business hours, we will respond to your email with in 24 hours. For any questions submitted on the weekend, a response will be received on Monday.

For immediate assistance during business hours M-F (excluding major holidays), please contact us.

You Viewed